sinI [2018-02-13T15:13:20.000Z]

antagonist of SinR, drives SlrR from the SlrR(LOW) to the SlrR(HIGH) state

Locus: BSU24600

Isoelectric point: 6.33

Molecular weight: 6.47 kDa

Protein length: 57 aa

Gene length: 171 bp

Function: control of biofilm formation

Product: antagonist of SinR

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → Transition state regulators
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation

Gene

Phenotypes of a mutant

• altered cell death pattern in colonies PubMed

The protein

Paralogous protein(s)

• SlrA

Structure

• 1B0N (complex SinR-SinI) PubMed

Expression and Regulation

Operons

• Genes: sinI-sinR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, in a portion of cells PubMed, in Spo0A regulon
  • SinR: repression, PubMed, in SinR regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • repressed during exponential growth (ScoC) PubMed

  Additional information

  • the mRNA is stabilized upon depletion of RNase Y PubMed

Biological materials

Mutant

• GP959 (spc), available in Jörg Stülke's lab
• DS91 (spc) NCIB3610 derivate, available in Jörg Stülke's lab
• 1S98 ( sinI::kan), PubMed, available at BGSC
• GP1663 (yqhG-sinI-sinR-tasA), available in Jörg Stülke's lab
• BKE24600 (ΔsinI::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC
• BKK24600 (ΔsinI::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGCAGTTTCTCCTCCTAA, downstream forward: _UP4_TGAATGTGCTATAATATCAC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Modelling of the SinI]/[[SinR] switch

Loading

Original publications

Loading